Résistance profonde en cas de récurrence de la fièvre paratyphoïde

Nous décrivons un cas de fièvre paratyphoïde rechute dans lequel l’isolat avait une sensibilité réduite à la ciprofloxacine en raison d’une mutation rare dans le gène gyrA Fluorodésoxyglucose tomographie par émission de positrons numérisation identifié infection profonde y compris une aortite insoupçonnée et souligne l’utilité de nouvelles techniques d’imagerie pour améliorer notre compréhension et traitement de cette maladie

Des mois après son retour d’Inde, où elle avait visité Hyderabad, Delhi et Mumbai Salmonella enterica sérotype Paratyphi A a été isolée de son tabouret Cependant, une semaine après avoir terminé le traitement, elle a présenté à notre hôpital des symptômes récurrents et une aggravation de la douleur dans le bas du dos. Paratyphi A a ensuite été isolée des hémocultures et a récidivé la fièvre paratyphoïde. Bien que l’isolat ait semblé sensible à la ciprofloxacine lors des tests standard de diffusion du disque , il était résistant à l’acide nalidixique. Cette découverte a incité à mesurer la CMI de la ciprofloxacine par le test E Biodisk, qui a révélé une sensibilité réduite. L’isolat original de selles du patient, traité dans un autre hôpital, n’a pas été testé avec un disque d’acide nalidixique B D’autres isolats étaient sensibles à la ceftriaxone, à l’ampicilline, à la gentamicine, à la triméthoprime et à l’imipénem. Bien que la récidive de la ciprofloxacine ait été à l’origine de la récidive de la maladie, l’ostéomyélite vertébrale, l’IRM, et l’ostéomyélite vertébrale La scintigraphie au technétium n’a révélé aucun signe d’infection profonde Deux jours après une IRM rachidienne normalisée au gadolinium, un fluorodéoxyglucose fluorodéoxyglucose à émission de positons est un analogue du glucose connu pour être absorbé par les macrophages et les neutrophiles activés, révélant une ostéomyélite vertébrale. Le traitement a été initié avec des semaines de ceftriaxone intraveineuse par jour et a été suivi par des mois de traitement par mg d’ofloxacine orale par jour et d’amoxicilline par jour, après quoi une récupération clinique complète a été obtenue. positr sur les tomographies par émission ont montré une amélioration considérable de l’aortite et de l’ostéomyélite à semaines et la résolution des changements par mois

Figure Vue largeDownload slideFluorodésoxyglucose tomographie par émission de positrons montrant une absorption accrue dans les vertèbres lombaires A et aorte BFigure View largeTélécharger DiapositiveDluorodésoxyglucose tomographie par émission de positrons montrant une absorption accrue dans les vertèbres lombaires A et aorte BGlobalement,% des cas de fièvre entérique sont causés par Salmonella enterica sérotype Typhi S Paratyphi A est de plus en plus isolé en Inde , et dans certaines régions de Chine il est la cause la plus fréquente de fièvre entérique Une minorité significative de tous les patients atteints de fièvre entérique rechute après traitement Une maladie récidivante peut entraîner une morbidité significative Les causes de la rechute peuvent être difficiles à identifier Un facteur important dans l’échec du traitement est la résistance aux antibiotiques non reconnue La sensibilité réduite à la ciprofloxacine a été reconnue à la fois dans S Typhi et S Paratyphi A , en particulier dans les isolats de l’Inde et d’ailleurs en Asie où l’incidence de la résistance aux antibiotiques continue d’augmenter La résistance à l’acide nalidixique est reconnue comme un bon prédicteur d’une sensibilité réduite à la ciprofloxacine et de l’échec du traitement par les fluoroquinolones dans la région déterminant la résistance aux quinolones du gène gyrA bactérien L’amplification par PCR de la région déterminant la résistance aux quinolones de cet isolat a été réalisée en utilisant les oligonucléotides gyrA-P TGTCCGAGATGGCCTGAAGC et gyrA-P TACCGTCATAGTTATCCACG Le séquençage a été effectué en utilisant un ABI Prism Trousse de séquençage cyclique Perkin Elmer et un séquenceur automatisé ABI Ceci a révélé une mutation ponctuelle dans le gène gyrA SerTyr, comparé à un isolat sensible Bien que fréquemment rapporté dans d’autres sérotypes de Salmonella , cette mutation est rarement associée à une sensibilité réduite aux quinolones. S Paratyphi A Cette affaire renforce l’importan des tests de routine pour les isolats S Typhi et S Paratyphi A pour la résistance à l’acide nalidixique et la nécessité de déterminer formellement la CMI pour la quinolone choisie comme traitement, en particulier chez les individus ayant voyagé dans des régions du monde où ces organismes ont été observés Si la CMI de la ciprofloxacine est de ⩾μg / mL, il faut envisager d’autres traitements, notamment les céphalosporines , l’azithromycine ou des quinolones plus récentes . La sensibilité réduite à la ciprofloxacine pourrait ne pas être le seul facteur de rechute. Maladie du patient Dans l’étude des isolats S Typhi résistant à l’acide nalidixique , seule une minorité de cas traités par l’ofloxacine de courte durée ont récidivé, suggérant que des facteurs autres que la sensibilité aux médicaments sont également importants. Dans ce cas, l’imagerie par tomographie par émission de positons de fluorodésoxyglucose était plus sensible que l’IRM pour la détection de l’ostéomyélite, et Plus important encore, peut-être, est que l’imagerie par tomographie par émission de positrons a été capable de détecter une aortite cliniquement insoupçonnée. L’aortite est souvent très difficile à détecter cliniquement et ne peut être identifiée que par TDM post-mortem et IRM. capable de détecter une dilatation anévrysmale, mais de telles infections sont bien établies et souvent une intervention chirurgicale majeure et des antibiothérapies prolongées sont nécessaires , la mortalité estimée chez les salmonelloses non-phytoplanctoniques étant de% -% La reconnaissance précoce et le traitement de l’aortite Ces images donnent non seulement un nouvel aperçu de la pathogenèse et de la rechute des maladies, mais montrent également que, lorsqu’elles sont disponibles, ces images pourraient influencer la prise en charge clinique et fournir une base rationnelle pour décider de la durée du traitement. les détails radiologiques, cliniques et microbiologiques fournissent un aperçu inhabituel o la complexité de la rechute de la maladie pour un seul patient

Remerciements

Conflits d’intérêts potentiels Tous les auteurs: pas de conflits