Analyse de souches pharmacorésistantes de Mycobacterium leprae dans une zone endémique du Vietnam

Voir le bref rapport de Ramien et Wong, e-eBackground La polychimiothérapie a effectivement réduit le nombre de cas de lèpre dans le monde Cependant, le taux de réduction a décéléré au fil des ans, permettant une détection précoce de Mycobacterium leprae et une étude épidémiologique de la rechute. Une étude épidémiologique moléculaire pour M leprae pharmacorésistant a été menée dans les régions du centre et des hauts plateaux du Vietnam. Un total d’échantillons prélevés sur des patients, y compris des patients avec de nouveaux cas, des patients sous traitement et des patients avec rechute ont été étudiés. pour la détection de M leprae avec des mutations liées à la pharmacorésistance en séquençant la région déterminant la résistance aux médicaments des gènes folP, rpoB et gyrA, qui sont responsables de la résistance à la dapsone, à la rifampicine et à l’ofloxacine, respectivement Résultats Dix-neuf mutations dans les échantillons du gène folP , et aucune mutation liée à la résistance aux médicaments ont été trouvés dans le RP Gènes oB ou gyrA Des échantillons de patients présentant une rechute ont montré des taux de mutation folP aussi élevés que%, et les taux de mutation dans les échantillons de nouveaux cas récents étaient inférieurs à%. Conclusions Notre étude a montré des taux élevés de résistance à la dapsone chez les patients présentant une rechute, par rapport aux patients présentant des cas nouveaux et récents de lèpre. En outre, il a été observé que de nombreux patients présentant une rechute avaient des mutations résistantes à la dapsone avaient des antécédents de traitement par dapsone en monothérapie

La lèpre est une maladie infectieuse chronique causée par une infection à Mycobacterium leprae La stratégie actuelle de lutte contre la lèpre est basée sur la polychimiothérapie MDT, recommandée par l’OMS , qui a réussi à réduire le nombre de cas de lèpre dans le monde. la transition du nombre de cas enregistrés et de nouveaux cas s’élevant respectivement à ~, et ~ ,, est presque terminée Des souches pharmacorésistantes ont d’abord été trouvées dans, et la PCT a été conçue pour empêcher l’émergence et propagation de souches pharmacorésistantes Cependant, une souche présentant une résistance à la fois à la dapsone et à la rifampicine a été rapportée dans , et actuellement, d’autres rapports indiquent l’émergence de souches de M leprae résistantes aux médicaments multiples La détection et le contrôle de telles souches pharmacorésistantes sont essentiels dans les pays qui approchent des niveaux d’élimination de la lèpre, comme VietnamMDT a été très efficace au Vietnam et l’élimination de la lèpre. taux de prévalence de l’eprosy, & lt; La population a été atteinte au niveau national en Le taux de prévalence par, la population en était Cependant, la majorité des patients atteints de lèpre se trouvent dans les régions du centre et des hautes terres du Vietnam , comprenant les provinces, y compris les provinces Dans la région montagneuse et les provinces de la région du delta, le nombre de malades atteints de la lèpre a été réparti entre les provinces de la région montagneuse; le taux de prévalence des cas nouvellement détectés était des cas /, population, bien que le taux de prévalence globale était des cas /, population au niveau national Le taux de cas nouvellement détectés dans les provinces de la région delta était des cas /, population présenter le danger d’être des sources infectieuses possibles de la lèpre, mais aussi le risque de développer des cas de rechute Cependant, on sait peu de choses sur les effets de M leprae pharmacorésistant chez les patients atteints de lèpre, en particulier dans les cas de rechute. Des études épidémiologiques moléculaires sur les souches pharmacorésistantes ont été menées dans les provinces principalement dans les régions du centre et des hautes terres qui représentent les régions où la lèpre est endémique au Vietnam.

MATÉRIAUX ET MÉTHODES

Sensibilité de la réaction en chaîne de la polymérase

Le nombre de bacilles isolés à partir des pattes des souris nues a été compté en utilisant la méthode décrite par Shepard et al. Des dilutions en série des bacilles de M leprae ont été utilisées pour la réaction en chaîne par polymérase PCR dans notre étude foetus.

Spécimens cliniques

Des échantillons de frottis de peau fendus ou de biopsies à l’emporte-pièce ont été prélevés chez des malades atteints de lèpre après réception d’un consentement éclairé dans les régions du centre et des hautes terres du Vietnam: Danang, Quangnam, Quangngai, Binhdinh, Phuyen, Khanhhoa, Ninhthuan, Kontum, Gialai, Daknong et Daklak, et les échantillons ont été classés comme nouveaux avant de commencer la PCT, récemment recevant MDT, et les cas de rechute Rechute a été définie comme le développement de nouvelles lésions cutanées après l’achèvement de la PCT et l’augmentation de l’indice bactérien par & gt; Le total des échantillons incluait ceux des patients avec de nouveaux cas, des patients avec des cas récents recevant un traitement et des patients avec une période de rechute: mars-août Parmi les patients avec rechute qui ont eu des résultats positifs de PCR spécifique à M leprae, les cas étaient après rechute après MDT complète, deuxième rechute après la dapsone en monothérapie et la deuxième après la PCT et en rechute après le traitement par ofloxacine. Des échantillons ont été obtenus à partir des lésions cutanées des patients frottis sur lame ou biopsie. trempé dans des mL de% d’éthanol à la température ambiante sur le terrain, avant d’être envoyé à Quyhoa National Leprosy & amp; Laboratoire de l’hôpital dermato-vénéréologie

Extraction d’ADN, PCR nichée et séquençage

Des matrices de M leprae des deux dilutions des bacilles de M leprae et des frottis de peau fendue ont été préparées par traitement avec le tampon de lyse à ° C pendant la nuit, comme décrit ailleurs amplification PCR Nested des régions de RLEP de M leprae modifications, en utilisant les amorces listées dans le tableau En bref, amplification PCR en utilisant des réactifs spéciaux mM Tris-HCl [pH], chlorure de magnésium mM, DTT mM, mg BSA, désoxynucléotides μM, sulfate de magnésium mM, et unités KOD-plus- Ver ADN polymérase [Toyobo] a été réalisée en utilisant l’ADN de l’échantillon comme matrices. Les première et seconde conditions de PCR étaient les suivantes; séparation des brins à ° C pour min, dénaturation à ° C pour s, recuit à ° C pour min, et extension à ° C pour incrément s plus s par cycle pour les cycles Les produits du premier PCR uL ont été utilisés comme modèles dans la seconde PCR La PCR nichée pour DRDR a été réalisée en utilisant les paires d’amorces listées dans le tableau Les mutations ont été mesurées sur le gène folP pour la dapsone , le gène rpoB pour la rifampicine, et le gène gyrA pour l’ofloxacine On a réalisé une amplification PCR en utilisant des réactifs standard Tris-HCl mM [pH,], chlorure de magnésium mM, dNTPs μM, et des unités TaKaRa Ex Taq ADN polymérase [Takara shuzo] en utilisant un ADN génomique comme modèles Les paires d’amorces utilisées pour amplifier les gènes spécifiques de résistance aux médicaments sont présentées dans le tableau. La condition de réaction était s à ° C, s à ° C et min à ° C pour les cycles.

Séquences de table des amorces utilisées dans cette étude Nom Utilisation Séquence de gènes, ‘→’ Taille de référence, bp K Première PCR F RLEP CGTGGGTGTGAGGATAGTTGT- Étude actuelle K Première PCR R RLEP GATCATCGATGCACTGTTCACT- Étude actuelle LP Premier ou deuxième PCR F RLEP TGCATGTCATGGCCTTGAGG- LP Première ou deuxième PCR R RLEP CACCGATACCAGCGGCAGAA LP Deuxième PCR F RLEP TGAGGTGTCGGCGTGGTC LP Deuxième PCRR RLEP CAGAAATGGTGCAAGGGA F Deuxième PCR F folP GCAGGTTATTGGGGTTTTGA Étude présente F Premier PCRR folP CCACCAGACACATCGTTGAC Étude présente F Deuxième PCR F folP CTTGATCCTGACGATGCTGT Etude présente F Deuxième PCRR folP ACATCGTTGACGATCCGTG Etude actuelle F Séquençage amorce F folP ATCCTGACGATGCTGTCCA Étude actuelle – F Amorce de séquençage R folP ACATCGTTGACGATCCGTG Étude actuelle – R Première PCR F rpoB CAGACGCTGATCAATATCCGT Étude actuelle R Première PCR R rpoB CAGCGGTCAAGTATTCGATC Étude actuelle R Deuxième PCR F rpoB CAATATCCGTCCGGTGGTC Présent stu dy R Deuxième PCR RppoB GTATTCGATCTCGTCGCTGA Étude actuelle R Amorce de séquençage F rpoB ACGCTGATCAATATCCGTCC Étude actuelle – R Amorce de séquençage R rpoB CGACAA TGAACCGATCAGAC Étude actuelle – G Première PCR F gyrA ACGCGATGAGTGTGATTGTGG Étude présente G Première PCR R gyrA TCCCAAATAGCAACCTCACC Etude présente G Deuxième PCRF gyrA GATGGTCTCAAACCGGTACA étude G Deuxième PCR R gyrA CCCAAATAGCAACCTCACCA Étude actuelle G Amorce de séquençage F gyrA GATGGTCTCAAACCGGTACA Étude actuelle – G Amorce de séquençage R gyrA CCCAAATAGCAACCTCACCA Étude actuelle – Nom Utilisation Séquence de gènes, ‘→’ Taille de référence, pb K Première PCR F RLEP CGTGGGTGTGAGGATAGTTGT- Étude actuelle K Première PCR R RLEP GATCATCGATGCACTGTTCACT- Etude actuelle LP Premier ou deuxième PCR F RLEP TGCATGTCATGGCCTTGAGG- LP Premier ou deuxième PCR R RLEP CACCGATACCAGCGGCAGAA LP Deuxième PCR F RLEP TGAGGTGTCGGCGTGGTC LP Deuxième PCRR RLEP CAGAAATGGTGCAAGGGA F Seco Etude PCR F FolP GCAGGTTATTGGGGTTTTGA Étude actuelle F Première PCRR folP CCACCAGACACATCGTTGAC Etude présente F Deuxième PCR F folP CTTGATCCTGACGATGCTGT Etude présente F Deuxième PCRR folP ACATCGTTGACGATCCGTG Etude présente F Amorce séquençante F folP ATCCTGACGATGCTGTCCA Etude présente – F Amorce séquençante R folP ACATCGTTGACGATCCGTG Etude actuelle – R Première PCR F rpoB CAGACGCTGATCAATATCCGT Etude actuelle R Première PCR RppoB CAGCGGTCAAGTATTCGATC Etude actuelle R Deuxième PCR F rpoB CAATATCCGTCCGGTGGTC Etude actuelle R Deuxième PCR RppoB GTATTCGATCTCGTCGCTGA Etude en cours R Séquençage amorce F rpoB ACGCTGATCAATATCCGTCC Etude en cours – R Séquençage amorce R rpoB CGACAA TGAACCGATCAGAC Etude actuelle – G Première PCR F gyrA ACGCGATGAGTGTGATTGTGG Étude présente G Première PCR R gyrA TCCCAAATAGCAACCTCACC Etude présente G Deuxième PCRF gyrA GATGGTCTCAAACCGGTACA Etude présente G Deuxième PCR R gyrA CCCAAATAGCAACCTCACCA Présent stu dy G Amorce de séquençage F gyrA GATGGTCTCAAACCGGTACA Étude actuelle – G Amorce de séquençage R gyrA CCCAAATAGCAACCTCACCA Étude actuelle – View LargeLes amplicons ont été visualisés par électrophorèse sur gel d’agarose, et l’ADN a été récupéré du gel en utilisant des kits d’extraction de gel Mini-Elute. utilisant le kit de séquençage ABI Prism BigDye Terminator Cycle Perkin-Elmer Applied Biosystems et fonctionnant sur un analyseur ABI Prism Genetic Applied Biosystems Les données de séquence ont été analysées par le programme d’analyse d’ADN Genetyx-MAC, version GENETYX, et comparées à celles de la base de données GenBank

RÉSULTATS

Sensibilité à la PCR

Des dilutions en série des bacilles de × – × ont été préparées pour déterminer les sensibilités PCR Les ADN génomiques ont été extraits des diluants avec l’utilisation des méthodes décrites dans Matériels et méthodes La PCR nested RLEP mentionnée précédemment RLEP-L était capable de détecter × bacilles dans les échantillons Figure a La PCR nested RLEP nouvellement conçue, utilisant les amorces K et K pour la première PCR et les amorces LP et LP pour la deuxième PCR appelée RLEP-K, est capable de détecter des comptes comparables de bacilles Figure b et RLEP Les produits -K sont visualisés plus clairement avec moins de bandes de frottis. Par conséquent, le nouveau système RLEP-K a été utilisé pour la détection dans des expériences ultérieures avec l’utilisation d’échantillons cliniques

Les produits de PCR nichés ont été visualisés sur% gel d’agarose A, PCR RLEP-L nested RLEP en utilisant des amorces, la taille des produits finaux LP-LP, bp B, PCR RLEP-nested RLEP-K en utilisant amorces, K, K, LP et LP taille des produits finaux, bp C, PCR nichée en folP avec FF D, PCR nichée rpoB en utilisant RR E, PCR nichée en gyrA en utilisant G-GFigure View largeDownload slideSensibilité de la réaction en chaîne par polymérase nichée PCR Les produits de PCR nichés ont été visualisés sur% gel d’agarose A, PCR RLEP-L nested RLEP-L utilisant des amorces, LPP LP taille des produits finis, bp B, RLEP-nested PCR RLEP-K utilisant des amorces, K, K, LP et LP PCR finale, bp C, PCR nichée sur folP en utilisant FF D, PCR nichée sur rpoB en utilisant RR E, PCR nichée en gyrA en utilisant des ADN G-GUsing extraits des dilutions en série de M leprae, nous avons déterminé la sensibilité de la PCR nichée pour DRDR La limite d’amplification par PCR était × – × bacilles Figure c-e

PCR nested RLEP pour les échantillons cliniques

Les méthodes de PCR ont été appliquées sur des échantillons cliniques prélevés dans des zones d’endémicité au Vietnam. Premièrement, nous avons testé le RLEP-K pour la détection de M leprae après extraction d’ADN d’échantillons de frottis Les bandes positives ont été obtenues par électrophorèse sur gel était% Les patients fournissant les échantillons ont été divisés en catégories: nouveau, rechute et cas récents Les taux positifs de RLEP-K par catégorie étaient respectivement de%,% et%

Tableau Positivité de la réaction en chaîne de la polymérase dans les nouveaux cas, les rechutes et les cas récents Catégorie de cas Non RLEP folP rpoB gyrA Nouveau% Rechute% Récente% Total%%%% Catégorie de cas Non RLEP folP rpoB gyrA Nouveau% Rechute% Récente% Total%%%% Voir Grand

Mutations dans des échantillons cliniques

Des échantillons positifs ont été trouvés dans des échantillons de folP, mais aucune mutation liée à la pharmacorésistance n’a été notée dans les échantillons de gènes rpoB et gyrA. Les mutations détectées ont été détectées dans les DRDR de folP, rpoB et du gène gyrA. Les cas d’ACC à ATC dans le codon thréonine à isoleucine, les cas de CCC à CGC dans codon proline à arginine, et les cas de CCC à CTC proline à leucine Deux nouveaux cas, cas de rechute, et des cas récents ont eu des mutations sur Les taux de mutation folP dans les catégories étaient respectivement%,% et%

Tableau Nombre de mutations sur folP Catégorie de cas Nombre de cas positifs pour la PCR Nombre de mutations mutations ratio Nombre de mutations dans les types de mutation Nouveau% th: CCC-CGC Rechute% rd: ACC-ATC th: CCC-CGC th: CCC-CTC % Rd: ACC-ATC th: CCC-CGC th: CCC-CTC Catégorie de cas Nombre de cas PCR-positifs Nombre de mutations mutations ratio Nombre de mutations dans les types de mutation Nouveau% th: CCC-CGC Rechute% rd: ACC-ATC th : CCC-CGC th: CCC-CTC Récents%: ACC-ATC th: CCC-CGC th: CCC-CTC View Large Certaines mutations faux-sens, dont l’association avec la pharmacorésistance est inconnue, ont été détectées dans le gène rpoB à partir d’échantillons cliniques Un patient avec rechute a montré une mutation de CAG glutamine à CAT histidine au codon Un nouveau patient a montré des mutations au codon de CAG glutamine à CAT histidine et au codon de GCG alanine à TCG sérine séquence les électrophérogrammes ont indiqué des pics doubles d’un second nucléotide au niveau du codon chez des patients classés comme ayant des cas récents Un pic était G identique à celui de type sauvage et l’autre pic était T, qui changeait l’acide aminé de la glycine GGC en valine GTC; données non affichées

La relation entre le traitement et les mutations pharmacorésistantes chez les patients présentant une rechute

Les patients ayant eu une rechute ont été classés en groupes selon l’historique du traitement. Groupe Groupe comprenant ceux traités par dapsone en monothérapie Le groupe a inclus des patients ayant reçu un diagnostic de deuxième rechute, une fois après un traitement par dapsone en monothérapie et, par la suite, après une PCT Pendant des mois, le groupe a été traité avec de l’ofloxacine en monothérapie. Huit des patients avec des rechutes amplifiées par le folP% ont eu des mutations sur le gène folP Sept% des patients rechutés ont été catégorisés en groupes et ont également eu des mutations folP. aucun des gènes

Tableau Mutations notées dans les cas de rechute positive du RLEP, par groupe de traitement Groupe Traitement antérieur Non Mutation sur folP Mutation sur rpoB Mutation sur gyrA DDS mois MDT un DDS plus MDT mois OFX Tous … un groupe Traitement antérieur Non Mutation sur folP Mutation sur rpoB Mutation sur gyrA DDS MDT mois a DDS plus MDT mois OFX Tous … a Abréviations: DDS diaminodiphénylsulfone, dapsone en monothérapie; MDT, traitement multidrogue; OFX, Ofloxacine monotherapyaUnknown DR mutationVoir Grand

Surveillance des mutations chez les patients

Cent sept échantillons de frottis de peau fendue de patients ont été prélevés avec des consentements à différents moments de chaque patient pour surveiller les mutations sous traitement. Le tableau montre la différence dans les résultats de mutation entre ces patients Les autres patients n’ont montré aucune mutation pendant le monitorage Patients A, B et C qui présentaient de nouveaux cas, présentaient un profil similaire, sans mutation au premier test et mutation du codon sur le gène folP au cours de la PCT. Cependant, des doubles pics de T et C dans la seconde base ont été observés sur folP chez les patients D et E , qui avait des cas de rechute et avait terminé la dapsone en monothérapie des années auparavant, avait une mutation sur folP in et aucune mutation après la MDT

Tableau Suivi des patients atteints de lèpre multibacillaire pour la mutation folP Patient Catégorie de cas Date d’obtention de l’échantillon Méthode d’obtention du site Exemple de mutation folP A Nouveau Avril Biopsie abdominale Nonea Janvier Ligature du lobe occulaire ACC → ATC / ACC Janvier Abdomen frottis ACC → ATC / ACC B Nouveau Frottis du lobe facial Aucun Mars Frottis cutané Aucun Novembre Frottis cutané ACC → ATC / ACC C Nouveau Juillet Frottis cutané Aucun Janvier Frottis cutané ACC → ATC / ACC Janvier Frottis cutané ACC → ATC / ACC D Rechute Novembre Lésion du lobe ombilical CCC → CGC Janvier Frottis cutané Aucun E Rechute Jannuary Frottis Aucun Janvier Earlobe frottis CCC → CGC Janvier Frottis Aucun Patient Catégorie de cas Date d’obtention de l’échantillon Méthode d’obtention du site d’échantillonnage mutation folP A Nouveau Abdomen biopsie Nonea Janvier Earlobe frottis ACC → ATC / ACC Janvier Abdomen frottis rd ACC → ATC / ACC B Nouveau mai Frottis du lobe du nez Aucun Mars Frottis cutané Aucun Novembre Frottis cutané ACC → ATC / ACC C Nouveau Juillet Frottis cutané Aucun Janvier Frottis cutané ACC → ATC / ACC Janvier Frottis cutané ACC → ATC / ACC D Rechute Novembre Earlobe frottis CCC → CGC Janvier Frottis cutané Aucun E Rechute Jannuary Frottis de bras Aucun Janvier Earlobe frottis CCC → CGC Janvier Frottis de bras Aucun aCNC ATC / ACC indique des pics doubles dans la deuxième base au codon View Large

DISCUSSION

taux de résistance à la dapsone chez les patients présentant une rechute: la réinfection par la souche primaire résistante aux médicaments indiquant des rechutes a été recueillie dans la province du centre du Vietnam, où la prévalence de la lèpre était la plus élevée et où les taux de rechute étaient élevés et la réactivation Bien que l’on ne sache pas encore si les rechutes sont dues à une réinfection par M leprae ou à la réactivation de M leprae persistant, une corrélation étroite entre la pharmacorésistance et la rechute a été reconnue dans plusieurs études La proportion d’échantillons montrant une mutation du gène folP liée à la résistance à la dapsone était de% dans les échantillons des régions centrales et montagneuses du Vietnam Comparaison avec les rapports précédents de Corée du Sud% indique des taux plus faibles de rechute dans ces régions du Vietnam a été trouvé dans les régions DRDR de rpoB dans tous les échantillons Fréquences de mutation du gène rpoB a re également très faible dans d’autres rapports Concernant les autres régions d’Asie du Sud-Est, aucun cas de résistance à la rifampicine n’a été détecté aux Philippines,% au Myanmar et% en Indonésie. Cependant, au Japon, où la prévalence de la lèpre est très élevée. Le taux de résistance à la rifampicine rapporté est très élevé, dans% des cas L’utilisation à long terme de médicaments en dehors du schéma standard de la PCT dans les cas de lèpre japonaise pourrait avoir contribué à promouvoir cette résistance à la rifampicine. Aucune mutation n’a été trouvée. dans le DRDR du gène de M leprae rpoB provenant de patients atteints de lèpre, y compris des cas de rechute au Vietnam Une explication possible pourrait être le succès du contrôle de la lèpre au Vietnam et l’efficacité de la MDT correctement administrée dans laquelle la rifampicine – avec ses propriétés bactéricides – efficace contre l’apparition de bacilles résistants aux médicaments En revanche, la dapsone n’est pas bactéricide en soi, bien qu’elle soit capable de supprimer ont été utilisés en monothérapie, peuvent avoir permis aux bactéries survivant chez le patient recevant un traitement de développer des mutations, leur donnant une résistance contre le médicament Bien que l’apparition de M leprae pharmacorésistant ait été maintenue très faible après l’application de la PCT avaient déjà été traités par dapsone en monothérapie. La Table Jing et al a rapporté que les patients atteints de lèpre multibacillaire qui ont été traités par MDT après une monothérapie par dapsone peuvent présenter un risque plus faible de rechute précoce tout en continuant à courir le risque de rechute tardive. de la PCT peut être entravée chez certains patients par la présence de M leprae résistant à la dapsone dans leur corps, ce qui pourrait entraîner une rechute tardive. Des observations similaires ont été rapportées soupçonnant l’implication des effets de la dapsone en monothérapie chez des patients rechuteurs. aucune mutation dans les principaux sites de résistance aux médicaments sur le gène rpoB Cependant, nous avons observé Ces mutations dans le gène rpoB sont une constatation appelant à plus de clarificationPour révéler la relation possible entre le traitement et la mutation génique, certains patients atteints de lèpre ont été surveillés pour des mutations de gènes dans lumière des traitements médicamenteux Les résultats ont montré une incidence de M leprae résistant à la dapsone chez les patients recevant la PCT, suggérant que certains des patients rechutés préalablement traités par dapsone en monothérapie pourraient avoir des infections persistantes avec M leprae résistant à la dapsone. Tableau Les résultats suggèrent que nous devons connaître la relation entre la situation des patients atteints de lèpre et la résistance aux médicaments. Dans l’ensemble, notre étude a montré un taux élevé de résistance à la dapsone chez les patients D’autres patients atteints de lèpre En revanche, un outc inattendu Notre étude a montré que nous ne pouvions pas trouver de mutations sur le gène rpoB chez les patients présentant une rechute. De plus, il a été démontré que de nombreux patients présentant une rechute présentant des mutations résistantes à la dapsone avaient des antécédents de traitement par dapsone en monothérapie. rechute, pharmacorésistance et dapsone en monothérapie, il serait peut-être nécessaire d’investiguer la persistance de M leprae pharmacorésistant grâce à une surveillance à grande échelle. Nous remercions tous les médecins travaillant dans les centres de santé locaux des provinces du centre et des hautes terres du Vietnam. aide à la collecte des échantillons cliniques Soutien financier Ce travail a été soutenu par le Ministère de la Santé du Vietnam; Quyhoa National Lèpre & amp; Hôpital dermato-vénéréologique, Vietnam; Fondation japonaise des sciences de la santé; et une subvention de recherche en sciences de la santé – Recherche sur les maladies infectieuses émergentes et réémergentes, Ministère de la santé, du travail et de la protection sociale, Japon Conflits d’intérêts potentiels Tous les auteurs: aucun conflit